bio+tech

mOmar — Wed, 22 Feb 2012 02:25:56 +0000

Biotech for Hackers

Many software developers have extensive experience and interest in dealing with large data sets, finding correlations and creating meaningful solutions. However, much of our generation has had little exposure to these problems. Often resulting in the bandwagon effect. Fig 1 shows something very similar to social interaction maps one comes across at places like Facebook.

Fig 1: Interaction map of genes implicated in Alzheimer’s. Genes were grouped by those that have similar functions (squares) and those with different functions (circles). Modules with a red border have high confidence interactions. While the weight of the connecting green lines corresponds to the number of interactions between two sets.

The map above is of individual gene relationships where an algorithm began with 12 seed genes that previous experiments have shown to play a role in Alzheimer’s disease. These seeds were compared with 185 new candidate genes from regions deemed susceptible to carrying Alzheimer’s genes. From here, both experimental and computational data was combined to generate Fig 1, which the authors dubbed AD-PIN (Alzheimer’s Disease Protein Interaction Network).

A low hurdle to entry along with the ability to iterate rapidly is key to taking on problems & creating solutions. What do these solutions look like in genomics and why can hackers lead the way? Progress has often been linked to literacy, from books to programming, being able to read and write in life-code just might be the next stage.

A cross-post by Mo from petridishtalk.com

Original published study: Interactome mapping suggests new mechanistic details underlying Alzheimer’s disease by Soler-Lopez et al.

Try It, You’ll Like It

mOmar — Tue, 21 Feb 2012 02:31:47 +0000

Normal Conference VS Developer Conference. SHDH Illustrated by Derek Yu

Attending gatherings for software developers in silicon valley, their hackathons leave much to be desired at bio events like Sagecon, the least of which being the beer.

Hopefully this will be a fun tool for folks not well acquainted with genomics/programming to sandbox and explore in.

The National Center for Biotechnology Information (NCBI) provides a command line based standalone Basic Local Alignment Search Tool (BLAST) package known as BLAST+ to analyze and play with genomic sequence data. Although, the legacy web based BLAST can perform a range of functions, BLAST+ as a command line tool is much better to understand and analyze large amounts of nucleotide data. It may be best to get an idea of what sort of data we’re dealing with by getting into the government’s database:

mokas$ ftp ftp.ncbi.nlm.nih.gov
Connected to ftp.wip.ncbi.nlm.nih.gov.
220-
 Warning Notice!

 This is a U.S. Government computer system, which may be accessed and used
 only for authorized Government business by authorized personnel.
 Unauthorized access or use of this computer system may subject violators to
 criminal, civil, and/or administrative action.

 All information on this computer system may be intercepted, recorded, read,
 copied... There is no right of privacy in this system.

Don’t worry about the scary message, this is all public data… well until the funding stops. Take a look in the blast/db directory for many pre-formatted databases NCBI has provided, i.e. genomic & protein reference sequences, patent nucleotide sequence databases from USPTO & EU/Japan Patent Agencies. Get yourself the latest BLAST+ from blast/executables/LATEST , I used ncbi-blast-2.2.25+-universal-macosx.tar.gz .

Installation:

mokas$ tar zxvpf ncbi-blast-2.2.25+-universal-macosx.tar.gz 
mokas$ PATH=/Users/mokas/Desktop/ncbi-blast-2.2.25+/bin
mokas$ export PATH
mokas$ echo $PATH
/Users/mokas/Desktop/ncbi-blast-2.2.25+/bin
mokas$ mkdir ./blast-2.2.25+/db
mokas$ blastn -help
USAGE
  blastn [-h] [-help] [-import_search_strategy filename]
...

Databases should be loaded directly into /db directory created above with the mkdir command. The last thing that needs to be done is to make a “.ncbirc” text file in the main directory containing the following:

[BLAST]
BLASTDB=/Users/mokas/Desktop/ncbi-blast-2.2.25+/db

This will guide the program to where data is being kept. At the end of the day we should hope to get something like this:

mokas$ blastn -query Homo_sapiens.NCBI36.apr.rna.fa -db refseq_rna
BLASTN 2.2.25+
...
Query=  ENST00000361359 ncrna:Mt_rRNA chromosome:NCBI36:MT:650:1603:1
gene:ENSG00000198714
Length=954
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

ref|XR_109154.1|  PREDICTED: Homo sapiens hypothetical LOC1005054...   464    5e-128

>ref|XR_109154.1| PREDICTED: Homo sapiens hypothetical LOC100505479 (LOC100505479),
partial miscRNA
Length=266

 Score =  464 bits (251),  Expect = 5e-128
 Identities = 255/257 (99%), Gaps = 0/257 (0%)
 Strand=Plus/Minus

Query  334  CACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACAT  393
            |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||
Sbjct  257  CACCTGAGTTGTAAAAAACTCCAGTTGATACAAAATAAACTACGAAAGTGGCTTTAACAT  198

BLAST+ in action.

Much thanks are in order to Dr. Tao Tao of NCBI

A cross-post by Mo from petridishtalk.com

Citations: Standalone BLAST Setup for Unix – BLAST® Help – NCBI Bookshelf

October 2011 bio+tech

Brad — Wed, 19 Oct 2011 22:19:50 +0000

Tuesday, October 18, 2010
Time: 7:00pm
Event Page: Eventbrite
Location: Giordano Bros. 3108 16th St, SF, CA (note, this is a brand new Giordano Bros – NOT the one on Columbus Ave in North Beach!)
Contact: windmiller[at]gmail[dot]com
Please RSVP!

The Scoop: On September 13th we had a fantastic kick-off for Bio+Tech at Giordano Bros in the Mission in SF! What a great turnout, and from eveyone I interacted with, I’d have to say that I was very impressed with the diversity of ideas, skill sets and people. Once again in October we’ll be teaming with our friends from Hackers and Founders to bring even more great people in to the mix! We hope you can make it – come, grab a beer and meet some fantastic new folks or even future collaborators!

As a note, many of you asked if there could be a medical and/or healhtcare slant to the meet up – of course! It’s all one big ecosystem – from consumer health, to new biopharma, to delivery models, and genomics – there’s tons of room for all.

We’ll be hosting this at the new Giordano Bros in the Mission – they have a shop in North Beach already, but this place is brand new! Nothing like having an entrepreneur event actually hosted in a start-up!

Please RSVP here at Eventbrite so we know how many people to expect! Thanks!